skip navigation links
National Cancer Institute National Cancer Institute U.S. National Institutes of Health www.cancer.gov
EVS Logo NCI Term Browser Enterprise Vocabulary Services
Terminologies Value Sets Mappings
Version: 14.12e (Release date: 2014-12-29-08:00)
SearchBox Top
SearchBox Bottom
ISIS 3521 (Code C1788)

Terms & Properties Synonym Details Relationships Mapping View All  
Terms & Properties

Preferred Name: ISIS 3521

Definition: A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, ISIS 3521 hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells. (NCI04)

NCI-GLOSS Definition: A substance that is being studied in the treatment of cancer.

Label: ISIS 3521

NCI Thesaurus Code: C1788 (Search for linked caDSR metadata)

Synonyms & Abbreviations: (see Synonym Details)
Affinitac
Affinitak
CGP 64128A
DNA, d(P-thio)(G-T-T-C-T-C-G-C-T-G-G-T-G-A-G-T-T-T-C-A)
DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA)
ISIS 3521
LY900003
Protein Kinase C-Alpha Antisense

External Source Codes: 
CAS Registry Number 151879-73-1 (see NLM ChemIDplus info)
NSC Code 719337 (see NCI DTP info)
PDQ Closed Trial Search ID 42953 (check for NCI PDQ closed clinical trial info)
PDQ Open Trial Search ID 42953 (check for NCI PDQ open clinical trial info)
UMLS CUI C0666551

Other Properties:
code C1788
In_Clinical_Trial_For Non-Small Cell Lung Cancer; Locally Advanced or Metastatic Colorectal Cancer; Ovarian Carcinoma; Hormone Refractory Prostate Cancer; Metastatic Breast Cancer; Low-Grade Non-Hodgkin's Lymphoma; Melanoma.
Legacy_Concept_Name ISIS_3521
Semantic_Type Nucleic Acid, Nucleoside, or Nucleotide
Semantic_Type Pharmacologic Substance

Additional Concept Data: 
Defined Fully by Roles: No  

URL: http://ncit.nci.nih.gov/ncitbrowser/ConceptReport.jsp?dictionary=NCI_Thesaurus&code=C1788&ns=NCI_Thesaurus

Mainbox Bottom